Search This Blog

Monday, December 29, 2014

Melba Ketchum Shows Sample 140 Degradation in her YouTube Video


Abstract

While attempting to dispel contamination in Sample 140, Melba Ketchum demonstrated a failure to amplify and sequence the correct gene (cyt b). Similar situations were demonstrated for Samples 33 and 35. The likely cause is mispriming or self-priming of degraded DNA.


*****************************************************************************


Dr. Melba Ketchum, DVM, has opened a YouTube channel which presently contains six videos: two book promotions, a story about dogman, a press conference, a related study, and an attempt to show that her study samples were uncontaminated. The last video includes good explanations of DNA methodology worthy of a read by any interested party. Unfortunately for her, it also contains an example which shows that her sample was degraded, a point she has consistently denied, in spite of strong evidence to the contrary (see blogs at right). Does she ever check anything?

The example of interest here is an electropherogram and sequence at 30.01 minutes into the video, purportedly from the Sample 140 cytochrome b (cyt b) gene. This gene occupies positions 14747 through 15887 of the 16569 bp human mitochondrial genome as exemplified by the rCRS standard (see Phylotree at right). I did a BLAST™ search of this purported cyt b sequence from the video:

CTTGTGCGGGATATTGATTTCACGGAGGATGGTGG
TCAAGGGACCCCTATCTGAGGGGGGTCATCCATGG
 GGGCGAGAAGGGATTTG

with the result of a 100%ID match to the human 16434-16348 minus strand, covering the control region(16434-16384) and the HV-1 region (16383-16348), clearly 461 bp distant from the purported cyt b region (14747-15887), which was not sequenced. Primers are normally designed to sequence the plus strand for consistency, so something is clearly wrong here.

This means that the sample was misprimed, probably self-primed due to degradation. Consistent with the Ketchum electron micrographs showing regions of single-strand DNA, self-priming occurs when one strand primes the other, with the intervening gap of single strand DNA (here in the plus strand) serving as the template for the sequencing of the priming strand (minus here) in the gap. The cyt b primers were not effective in this case; the cyt b region was not amplified or sequenced because of the favored reactions on the self-primed strand in the control/HV-1 regions. This occurs all the time for microbially degraded or contaminated samples, and should have been a flag to the Ketchum team of “experts.” Peer reviewers pointed this out:

“…when they are likely explained by DNA degradation or contamination.”  

AND

“… in degraded DNA, artifactual amplifications are expected.” 

But what was Melba’s response?  

“The DNA was not degraded as we had a yield gel of the raw DNA showing clear bands (Figure 7) not smears.” (emphasis mine).

 Actually in her Figure 10, Sample 140 does show smears (degradation). There are even two major bands. 

Degradation of the type causing self-priming (type 1) may not even show up as smears because relatively short spans of single strands would not change the molecular weight by enough to be visibly distinct from the pure double strand sequence. Smears indicate a continuous range of relatively high molecular weight fragments (type 2) caused by severing both strands in numerous places, not short single strands among normal length double strands.

Also, the purposely degraded blood sample which Melba presents as an example of degradation in Figure 10 is of the second type (above), and in any case it should not have been presented as representative of field degradation in the real samples, as I pointed out in a previous blog. Most of her samples were hairs (not blood) exposed to environmental (not laboratory) conditions of heat and cold, light (especially UV), rain, and microbes at the least. Her lab experiment did not replicate these conditions. However, she says in her paper,

“…the contaminated, hemolyzed, degraded blood sample comprised a standard by which the unknown DNA obtained under more controlled conditions could be evaluated.” (emphasis mine).

“More controlled?” I say unknown field conditions are less controlled. The NCBI calls uncontrolled samples like this “environmental samples,” meaning that their reported DNA sequences cannot be associated with any known organism. Could Melba seriously have thought that her “controlled” laboratory treatment of unknown samples was the only possible source of degradation to which they were exposed? In her paper she makes a lot of the control samples from laboratory personnel but does not take seriously enough other possible sources of contamination or degradation. None of her samples were collected directly under sterile conditions from an animal and immediately preserved, as would normally be the case for a known animal sampled in a laboratory or even a person submitting a test kit to a laboratory by mail.    

These results are similar to those found in the TAP1 nuclear gene sequence for Sample 33 found on the Sasquatch Genome Project website (“Supplemental Raw Data” tab). In that case mitochondrial DNA was amplified and sequenced. Clearly the primer did not work there either. This and other anomalies are discussed in my third paper (see at right).

Possibly related is the strange case of Sample 35, the Arizona toenail, described in a previous blog (see at right). In that case Richard Stubstad, using Melba’s alleged cyt b sequence, drew incorrect conclusions from a few database comparisons. However, his sequence of 360 bp did not match the 446 bp length of a cyt b sequence which would be obtained from the stated primer pair MCB 398/MCB 869. This sequence was not published in Stubstad’s brief article (see at right), but we suspect it was not cyt b either.

In the light of the above, I call upon Melba Ketchum to release for public scrutiny all the “cyt b” sequences of the 111 samples in her study, all of which she claimed in her paper to be human.

In summary, while attempting to dispel contamination in Sample 140, Dr. Melba Ketchum, DVM, demonstrated failure to amplify and sequence the correct gene (cyt b), which is likely caused by sample degradation. She should have checked her results before going on YouTube, or in fact before writing her paper.  Melba had very condescending words for Prof. Bryan Sykes, however:

“That's why our study took so long, check and re-check among other things….he should have been more thorough…it’s just that they didn’t delve deep enough.”


Walk the talk, Melba.

 

 

 
 
 
 
 
 
 
 
 
 
 
 
 














 



 

 

No comments:

Post a Comment